|
New England Biolabs
reverse oligonucleotide primer Reverse Oligonucleotide Primer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/Random+Primer+Mix/pm38675973-65-14-26 Average 97 stars, based on 1 article reviews
reverse oligonucleotide primer - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
Eurofins
reverse mutagenic oligonucleotide primers Reverse Mutagenic Oligonucleotide Primers, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/mutagenesis+primers/pmc13142252-12-2-6 Average 86 stars, based on 1 article reviews
reverse mutagenic oligonucleotide primers - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Eurofins
oligonucleotides used for shape map library preparation 1 p53 rt primer tccactcggataagatgct 2 p53 forward atggaggagccgcagtcagat 3 p53 reverse tccactcggataagatgct Oligonucleotides Used For Shape Map Library Preparation 1 P53 Rt Primer Tccactcggataagatgct 2 P53 Forward Atggaggagccgcagtcagat 3 P53 Reverse Tccactcggataagatgct, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/oligonucleotides/pmc12510224-92-0-16 Average 86 stars, based on 1 article reviews
oligonucleotides used for shape map library preparation 1 p53 rt primer tccactcggataagatgct 2 p53 forward atggaggagccgcagtcagat 3 p53 reverse tccactcggataagatgct - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
|
Fisher Scientific
lamp2a sgrna reverse primer fisher scientific custom dna oligonucleotides Lamp2a Sgrna Reverse Primer Fisher Scientific Custom Dna Oligonucleotides, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/lamp2a+sgrna+reverse+primer+fisher+scientific+custom+dna+oligonucleotides/pmc12254369-41-7-5 Average 90 stars, based on 1 article reviews
lamp2a sgrna reverse primer fisher scientific custom dna oligonucleotides - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Spatial Transcriptomics Inc
reverse-transcribed oligonucleotide (dt) primers Reverse Transcribed Oligonucleotide (Dt) Primers, supplied by Spatial Transcriptomics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/reverse+transcribed+oligonucleotide++dt++primers/pmc11207393-273-12-0 Average 90 stars, based on 1 article reviews
reverse-transcribed oligonucleotide (dt) primers - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Macrogen
oligonucleotides reverse primer Oligonucleotides Reverse Primer, supplied by Macrogen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/reverse+primer/10__3126_slash_jnba__v5i1__63745-51-19-24 Average 90 stars, based on 1 article reviews
oligonucleotides reverse primer - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Bioneer Corporation
oligonucleotide primers for real-time reverse transcription-qpcr Oligonucleotide Primers For Real Time Reverse Transcription Qpcr, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/primers+for+real+time+rt+pcr+of+cytokines/pmc10819838-37-0-20 Average 90 stars, based on 1 article reviews
oligonucleotide primers for real-time reverse transcription-qpcr - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
oligonucleotides primer: hsqle-reverse Oligonucleotides Primer: Hsqle Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/oligonucleotides+primer++hsqle+reverse/pm37244259-278-48-50 Average 90 stars, based on 1 article reviews
oligonucleotides primer: hsqle-reverse - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Sangon Biotech
oligonucleotides primer: hmylip-reverse Oligonucleotides Primer: Hmylip Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+oligonucleotide+primer/oligonucleotides+primer++hmylip+reverse/pm37244259-278-72-74 Average 90 stars, based on 1 article reviews
oligonucleotides primer: hmylip-reverse - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |